shRNA Lentivirus (self-inactivating), pH1-(KCTD2-shRNA-Seq1)(CAT#: LV-SI0917WQ)

This product is a KCTD2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. KCTD2, an adaptor of Cullin3 E3 ubiquitin ligase, suppresses gliomagenesis by destabilizing c-Myc. The expression of KCTD2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert KCTD2-shRNA-Seq1
Related Target/Protein KCTD2
Region CDS
TargetSeq CCTACTTTGGTCCTATCCTCA
NCBI RefSeq NM_015353
Titer >1*10^10 GC/mL
Related Diseases Ischaemic Stroke and Alzheimer's Disease
Target Gene
Gene ID 23510
Uniprot ID Q14681

Related Products