shRNA Lentivirus (self-inactivating), pH1-(MRPL16-shRNA-Seq2)(CAT#: LV-SI0717WQ)
This product is a MRPL16-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Among different species, the MRPL16 encoded proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. The expression of MRPL16-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | MRPL16-shRNA-Seq2 |
Related Target/Protein | MRPL16 |
Region | 3UTR |
TargetSeq | GAAGTCTTTGGGTAGCTCTTA |
NCBI RefSeq | NM_017840 |
Alternative Names | L16mt; MRP-L16; PNAS-111 |
Titer | >1*10^10 GC/mL |
Related Diseases | Colorectal cancers |