shRNA Lentivirus (self-inactivating), pH1-(NCRNA00173-shRNA-Seq1)(CAT#: LV-SI0939WQ)

This product is a NCRNA00173-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of NCRNA00173-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert NCRNA00173-shRNA-Seq1
Related Target/Protein NCRNA00173
Region CDS
TargetSeq GCTCAGGTCACGTTACTCTAA
NCBI RefSeq NM_207436
Alternative Names LINC00173
Titer >1*10^10 GC/mL
Related Diseases Hepatocellular carcinoma
Target Gene
Gene ID 100287569
Uniprot ID Q6ZV60

Related Products