shRNA Lentivirus (self-inactivating), pH1-(Olfr564-shRNA-Seq1)(CAT#: LV-SI3118WQ)

This product is a Olfr564-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Olfr564 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr564-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Olfr564-shRNA-Seq1
Related Target/Protein Olfr564
Region CDS
TargetSeq CCTGATTCTCTTTGTCATTAT
NCBI RefSeq NM_146359
Alternative Names MOR14-10
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 258356
Uniprot ID E9PWA8

Related Products