shRNA Lentivirus (self-inactivating), pH1-(PRDM15-shRNA-Seq3)(CAT#: LV-SI0715WQ)

Datasheet

This product is a PRDM15-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The PRDM15 gene plays a role as a molecular node in a transcriptional network regulating embryonic development and cell fate decision. The expression of PRDM15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert PRDM15-shRNA-Seq3
Related Target/Protein PRDM15
Region CDS
TargetSeq CCGACTGTTCTTTGTTACATT
NCBI RefSeq NM_022115
Alternative Names PFM15; ZNF298; C21orf83
Titer >1*10^10 GC/mL
Related Diseases Pancreatic cancer
Target Gene
Gene ID 63977
Uniprot ID P57071

Related Products

shRNA Lentivirus (self-inactivating), pH1-(PIGW-shRNA-Seq1) (CAT#:LV-SI0640WQ) shRNA Lentivirus (self-inactivating), pU6-(COQ9-shRNA-Seq1) (CAT#:LV-SI0119WQ) shRNA Lentivirus (self-inactivating), pH1-(CDCA3-shRNA-Seq1) (CAT#:LV-SI0623WQ) Recombinant lentivirus, pU6-(Human hsa-miR-423-3p), Overexpression (CAT#:Lenti-GTOH0464WQ) shRNA Lentivirus (self-inactivating), p7SK-(Med18-shRNA-Seq3) (CAT#:LV-SI3580WQ) Recombinant lentivirus, pU6-(Mouse Bnip3L (S81A)), Overexpression (CAT#:Lenti-GTOH0019WQ) shRNA Lentivirus (self-inactivating), pU6-(Gvin1-shRNA-Seq5) (CAT#:LV-SI1757WQ) shRNA Lentivirus (self-inactivating), pH1-(ZDHHC19-shRNA-Seq1) (CAT#:LV-SI0579WQ)