shRNA Lentivirus (self-inactivating), pH1-(PRELID2-shRNA-Seq3)(CAT#: LV-SI0799WQ)

This product is a PRELID2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of PRELID2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert PRELID2-shRNA-Seq3
Related Target/Protein PRELID2
Region 3UTR
TargetSeq CCAATGCGTTATGATGATTAA
NCBI RefSeq NM_138492
Titer >1*10^10 GC/mL
Related Diseases Chronic Hepatitis B infection
Target Gene
Gene ID 153768
Uniprot ID Q8N945

Related Products