shRNA Lentivirus (self-inactivating), pH1-(Fdx1-shRNA-Seq1)(CAT#: LV-SI3099WQ)
This product is a Fdx1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Fdx1 gene encodes a small iron-sulfur protein that transfers electrons from NADPH through ferredoxin reductase to mitochondrial cytochrome P450, involved in steroid, vitamin D, and bile acid metabolism. The expression of Fdx1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Fdx1-shRNA-Seq1 |
Related Target/Protein | Fdx1 |
Region | CDS |
TargetSeq | GCCATTACTGATGAAGAGAAT |
NCBI RefSeq | NM_007996 |
Alternative Names | ADX; FDX; LOH11CR1D |
Titer | >1*10^10 GC/mL |