shRNA Lentivirus (self-inactivating), pH1-(RBM33-shRNA-Seq4)(CAT#: LV-SI2958WQ)
This product is a RBM33-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of RBM33-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | RBM33-shRNA-Seq4 |
| Related Target/Protein | RBM33 |
| Region | CDS |
| TargetSeq | GCATAATACAACTTCTCAGAA |
| NCBI RefSeq | NM_053043 |
| Alternative Names | PRR8 |
| Titer | >1*10^10 GC/mL |
