shRNA Lentivirus (self-inactivating), pH1-(SLC9A11-shRNA-Seq2)(CAT#: LV-SI0627WQ)
This product is a SLC9A11-shRNA encoding Lentivirus, which is based on HIV-1 serotype. SLC9A11 is a member of the sodium-hydrogen exchanger (NHE) family and involved in pH regulation. The expression of SLC9A11-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | SLC9A11-shRNA-Seq2 |
Related Target/Protein | SLC9A11 |
Region | CDS |
TargetSeq | CAAATTGTCTACCCTCTTCTA |
NCBI RefSeq | NM_178527 |
Alternative Names | SLC9C2 |
Titer | >1*10^10 GC/mL |
Related Diseases | Endometrial cancer |