shRNA Lentivirus (self-inactivating), pH1-(Zfand2a-shRNA-Seq1)(CAT#: LV-SI3066WQ)
This product is a Zfand2a-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Zfand2a gene has zinc ion binding ability. The expression of Zfand2a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Zfand2a-shRNA-Seq1 |
| Related Target/Protein | Zfand2a |
| Region | CDS |
| TargetSeq | CAATAACATGCGACGCCTGTA |
| NCBI RefSeq | NM_133349 |
| Alternative Names | AIRAP |
| Titer | >1*10^10 GC/mL |
