shRNA Lentivirus (self-inactivating), pU6-(CRAMP1L-shRNA-Seq2)(CAT#: LV-SI0381WQ)

This product is a CRAMP1L-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of CRAMP1L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert CRAMP1L-shRNA-Seq2
Related Target/Protein CRAMP1L
Region CDS
TargetSeq CCATCAGTATGCAGTCGGATT
NCBI RefSeq NM_020825
Alternative Names HN1L; TCE4; CRAMP1L
Titer >1*10^10 GC/mL
Related Diseases Lamotrigine (LTG)-induced maculopapular eruption (MPE)
Target Gene
Gene ID 57585
Uniprot ID Q96RY5

Related Products