shRNA Lentivirus (self-inactivating), p7SK-(FAM124A-shRNA-Seq3)(CAT#: LV-SI1289WQ)
This product is a FAM124A-shRNA encoding Lentivirus, which is based on HIV-1 serotype. FAM124A belongs to the FAM124 family. The expression of FAM124A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | FAM124A-shRNA-Seq3 |
Related Target/Protein | FAM124A |
Region | 3UTR |
TargetSeq | CGAAACACACAAACTCAGAGA |
NCBI RefSeq | NM_145019 |
Titer | >1*10^10 GC/mL |
Related Diseases | Mycoplasma pneumoniae pneumonia |