shRNA Lentivirus (self-inactivating), pU6-(Gm16776-shRNA-Seq4)(CAT#: LV-SI2086WQ)
This product is a Gm16776-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Gm16776 gene can regulate the immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell. The expression of Gm16776-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Gm16776-shRNA-Seq4 |
Related Target/Protein | Gm16776 |
Region | CDS |
TargetSeq | GAAGCCAAACCAAGCACCAAA |
NCBI RefSeq | XM_355759 |
Alternative Names | Trbv16; Tcrb-V11 |
Titer | >1*10^10 GC/mL |
Target Gene | |
---|---|
Gene ID | 100124680 |
Uniprot ID | A0A0B4J1H3 |