shRNA Lentivirus (self-inactivating), pU6-(JOSD2-shRNA-Seq1)(CAT#: LV-SI0371WQ)

This product is a JOSD2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The JOSD2 gene encodes a protein containing a Josephin domain. Josephin domain-containing proteins are deubiquitinating enzymes which catalyze the hydrolysis of the bond between the C-terminal glycine of the ubiquitin peptide and protein substrates. The expression of JOSD2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert JOSD2-shRNA-Seq1
Related Target/Protein JOSD2
Region CDS
TargetSeq CACCGGCAACTATGATGTCAA
NCBI RefSeq NM_138334
Alternative Names SBBI54
Titer >1*10^10 GC/mL
Target Gene
Gene ID 126119
Uniprot ID Q8TAC2

Related Products