shRNA Lentivirus (self-inactivating), pU6-(JOSD2-shRNA-Seq1)(CAT#: LV-SI0371WQ)
This product is a JOSD2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The JOSD2 gene encodes a protein containing a Josephin domain. Josephin domain-containing proteins are deubiquitinating enzymes which catalyze the hydrolysis of the bond between the C-terminal glycine of the ubiquitin peptide and protein substrates. The expression of JOSD2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | JOSD2-shRNA-Seq1 |
Related Target/Protein | JOSD2 |
Region | CDS |
TargetSeq | CACCGGCAACTATGATGTCAA |
NCBI RefSeq | NM_138334 |
Alternative Names | SBBI54 |
Titer | >1*10^10 GC/mL |