shRNA Lentivirus (self-inactivating), pU6-(OR5M11-shRNA-Seq4)(CAT#: LV-SI1570WQ)

This product is a OR5M11-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR5M11 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR5M11-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR5M11-shRNA-Seq4
Related Target/Protein OR5M11
Region CDS
TargetSeq GCCCTTCTACTCACTGAGTTT
NCBI RefSeq NM_001005245
Alternative Names OR11-199
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 219487
Uniprot ID Q96RB7

Related Products