shRNA Lentivirus (self-inactivating), pU6-(PIGY-shRNA-Seq2)(CAT#: LV-SI0068WQ)
This product is a PIGY-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by PIGY gene, which is well-conserved, is encoded by the same bicistronic transcript that encodes phosphatidylinositol glycan anchor biosynthesis, class Y, but the two proteins are unrelated. The expression of PIGY-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | PIGY-shRNA-Seq2 |
Related Target/Protein | PIGY |
Region | CDS |
TargetSeq | GATGACACGTCAAAGTAAGAA |
NCBI RefSeq | NM_032906 |
Alternative Names | PREY |
Titer | >1*10^10 GC/mL |
Related Diseases | Hyperphosphatasia and mental retardation syndrome |