shRNA Lentivirus (self-inactivating), pU6-(Trmt1-shRNA-Seq2)(CAT#: LV-SI2004WQ)

This product is a Trmt1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Trmt1 gene encodes a tRNA-modifying enzyme that acts as a dimethyltransferase, modifying a single guanine residue at position 26 of the tRNA. The expression of Trmt1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Trmt1-shRNA-Seq2
Related Target/Protein Trmt1
Region CDS
TargetSeq GCAAACGATTCAAAGAGGGTA
NCBI RefSeq NM_198020
Alternative Names TRM1; MRT68
Titer >1*10^10 GC/mL
Related Diseases Autosomal recessive intellectual disorder (ARID)
Target Gene
Gene ID 55621
Uniprot ID O75648

Related Products