shRNA Lentivirus (self-inactivating), pU6-(WDR74-shRNA-Seq3)(CAT#: LV-SI0453WQ)

This product is a WDR74-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The WDR74 gene participates in an early cleavage of the pre-rRNA processing pathway in cooperation with NVL and is required for blastocyst formation, is necessary for RNA transcription, processing and/or stability during preimplantation development. The expression of WDR74-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert WDR74-shRNA-Seq3
Related Target/Protein WDR74
Region CDS
TargetSeq GTGGGAAAGAGAATGCTTTGA
NCBI RefSeq NM_018093
Alternative Names Nsa1
Titer >1*10^10 GC/mL
Related Diseases Mammary adenocarcinoma
Target Gene
Gene ID 54663
Uniprot ID Q6RFH5

Related Products