shRNA Adeno-associated Virus Serotype 2, p7SK-(5730590G19Rik-shRNA-Seq1)(CAT#: AAV-SI4000WQ)

This product is a 5730590G19Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 5730590G19Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert 5730590G19Rik-shRNA-Seq1
Related Target/Protein 5730590G19Rik
Region CDS
TargetSeq CCAAAGAAGCTGAATTTCAAA
NCBI RefSeq NM_029835
Alternative Names Lrrk1; BC028450; Ticrr
Titer >1*10^10 GC/mL
Target Gene
Gene ID 77011
Uniprot ID Q8C6J3

Related Products

Advertisement