shRNA Adeno-associated Virus Serotype 2, p7SK-(JOSD2-shRNA-Seq1)(CAT#: AAV-SI1373WQ)

This product is a JOSD2-shRNA encoding AAV, which is based on AAV-2 serotype. The JOSD2 gene encodes a protein containing a Josephin domain. Josephin domain-containing proteins are deubiquitinating enzymes which catalyze the hydrolysis of the bond between the C-terminal glycine of the ubiquitin peptide and protein substrates. The expression of JOSD2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert JOSD2-shRNA-Seq1
Related Target/Protein JOSD2
Region CDS
TargetSeq CACCGGCAACTATGATGTCAA
NCBI RefSeq NM_138334
Alternative Names SBBI54
Titer >1*10^10 GC/mL
Target Gene
Gene ID 126119
Uniprot ID Q8TAC2

Related Products

Inquiry Now
Advertisement