shRNA Adeno-associated Virus Serotype 2, p7SK-(CCDC80-shRNA-Seq1)(CAT#: AAV-SI1493WQ)
This product is a CCDC80-shRNA encoding AAV, which is based on AAV-2 serotype. The CCDC80 gene promotes cell adhesion and matrix assembly. The expression of CCDC80-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | CCDC80-shRNA-Seq1 |
Related Target/Protein | CCDC80 |
Region | CDS |
TargetSeq | GAGTACGGAATGACCTACAAT |
NCBI RefSeq | NM_199511 |
Alternative Names | CL2; URB; DRO1; SSG1; okuribin |
Titer | >1*10^10 GC/mL |
Related Diseases | Metabolic disease |