shRNA Adeno-associated Virus Serotype 2, p7SK-(FANCI-shRNA-Seq1)(CAT#: AAV-SI1340WQ)
This product is a FANCI-shRNA encoding AAV, which is based on AAV-2 serotype. The FANCI gene encodes the protein for complementation group I. Alternative splicing results in two transcript variants encoding different isoforms. The expression of FANCI-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | FANCI-shRNA-Seq1 |
Related Target/Protein | FANCI |
Region | CDS |
TargetSeq | CCCTGTGTTATTCTTTCATTT |
NCBI RefSeq | NM_018193 |
Alternative Names | KIAA1794 |
Titer | >1*10^10 GC/mL |
Related Diseases | DNA Damage |