shRNA Adeno-associated Virus Serotype 2, p7SK-(FANCI-shRNA-Seq1)(CAT#: AAV-SI1340WQ)

This product is a FANCI-shRNA encoding AAV, which is based on AAV-2 serotype. The FANCI gene encodes the protein for complementation group I. Alternative splicing results in two transcript variants encoding different isoforms. The expression of FANCI-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert FANCI-shRNA-Seq1
Related Target/Protein FANCI
Region CDS
TargetSeq CCCTGTGTTATTCTTTCATTT
NCBI RefSeq NM_018193
Alternative Names KIAA1794
Titer >1*10^10 GC/mL
Related Diseases DNA Damage
Target Gene
Gene ID 55215
Uniprot ID Q9NVI1

Related Products

Inquiry Now
Advertisement