shRNA Adeno-associated Virus Serotype 2, p7SK-(MTRF1L-shRNA-Seq1)(CAT#: AAV-SI1368WQ)

This product is a MTRF1L-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by MTRF1L gene plays a role in mitochondrial translation termination, and is thought to be a release factor that is involved in the dissociation of the complete protein from the final tRNA, the ribosome, and the cognate mRNA. The expression of MTRF1L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert MTRF1L-shRNA-Seq1
Related Target/Protein MTRF1L
Region CDS
TargetSeq CGGGTCACAGATCACAGAATA
NCBI RefSeq NM_019041
Alternative Names MRF1L; HMRF1L; mtRF1a
Titer >1*10^10 GC/mL
Target Gene
Gene ID 54516
Uniprot ID Q9UGC7

Related Products

Inquiry Now
Advertisement