shRNA Adeno-associated Virus Serotype 2, p7SK-(C7orf42-shRNA-Seq2)(CAT#: AAV-SI1338WQ)

Datasheet

This product is a C7orf42-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C7orf42-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C7orf42-shRNA-Seq2
Related Target/Protein C7orf42
Region CDS
TargetSeq GCATCTCATGCACACCAGTTA
NCBI RefSeq NM_017994
Alternative Names TMEM248
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55069
Uniprot ID Q9NWD8

Related Products

shRNA Adeno-associated Virus Serotype 2, p7SK-(Nkd1-shRNA-Seq1) (CAT#:AAV-SI4033WQ) Recombinant adeno-associated virus type 2, pU6-(Human HTR2A), Overexpression (CAT#:AAV-GTOH0230WQ) Recombinant adeno-associated virus type 9, pU6-(Domestic silkworm Akt 3'UTR), Overexpression (CAT#:AAV-GTOH1327WQ) Recombinant adeno-associated virus type 9, pU6-(Rattus INPPL1 3'UTR), Overexpression (CAT#:AAV-GTOH1103WQ) AAV DJ8-CMV βGlobin (MCS-3Flag)-SV40 PolyA, NC (CAT#:AAV-GTK0500WQ) shRNA Adeno-associated Virus Serotype 2, pU6-(LOC392563-shRNA-Seq1) (CAT#:AAV-SI1564WQ) Recombinant adeno-associated virus type 2, pU6-(Human IL13RA2), Overexpression (CAT#:AAV-GTOH0170WQ) Recombinant adeno-associated virus type 2, pU6-(Human KAT2B ), Overexpression (CAT#:AAV-GTOH0481WQ)