shRNA Adeno-associated Virus Serotype 2, p7SK-(Nudcd1-shRNA-Seq3)(CAT#: AAV-SI3551WQ)
This product is a Nudcd1-shRNA encoding AAV, which is based on AAV-2 serotype. The Nudcd1 gene may be a suitable target for antigen-specific immunotherapy. The expression of Nudcd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Nudcd1-shRNA-Seq3 |
Related Target/Protein | Nudcd1 |
Region | CDS |
TargetSeq | GAGTAAATACGGAGAATTAAT |
NCBI RefSeq | NM_026149 |
Alternative Names | CML66; OVA66 |
Titer | >1*10^10 GC/mL |
Related Diseases | Solid tumors |