shRNA Adeno-associated Virus Serotype 2, p7SK-(SDHAF2-shRNA-Seq2)(CAT#: AAV-SI1480WQ)
This product is a SDHAF2-shRNA encoding AAV, which is based on AAV-2 serotype. The SDHAF2 gene encodes a mitochondrial protein needed for the flavination of a succinate dehydrogenase complex subunit required for activity of the complex. The expression of SDHAF2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | SDHAF2-shRNA-Seq2 |
Related Target/Protein | SDHAF2 |
Region | CDS |
TargetSeq | CCTGCTCTATGAGAGCAGAAA |
NCBI RefSeq | NM_017841 |
Alternative Names | PGL2; SDH5; C11orf79 |
Titer | >1*10^10 GC/mL |
Related Diseases | Paraganglioma |