shRNA Adeno-associated Virus Serotype 2, p7SK-(SEC63D1-shRNA-Seq1)(CAT#: AAV-SI1370WQ)

This product is a SEC63D1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by SEC63D1 gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. The expression of SEC63D1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert SEC63D1-shRNA-Seq1
Related Target/Protein SEC63D1
Region CDS
TargetSeq GCAAGGGAACTTGAATTGATT
NCBI RefSeq NM_198550
Alternative Names MER3; POF9; Si-11; HFM1; Si-11-6; helicase
Titer >1*10^10 GC/mL
Related Diseases Premature ovarian failure 9 (POF9)
Target Gene
Gene ID 164045
Uniprot ID A2PYH4

Related Products

Advertisement