shRNA Adeno-associated Virus Serotype 2, pH1-(APBA3-shRNA-Seq3)(CAT#: AAV-SI0814WQ)

This product is a APBA3-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by APBA3 gene is a member of the X11 protein family. It is an adapter protein that interacts with the Alzheimer's disease amyloid precursor protein. The expression of APBA3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert APBA3-shRNA-Seq3
Related Target/Protein APBA3
Region CDS
TargetSeq CACCAAGAGGATCAAGGTCTT
NCBI RefSeq NM_004886
Alternative Names X11L2; mint3; MGC:15815
Titer >1*10^10 GC/mL
Related Diseases Alzheimer's disease
Target Gene
Gene ID 9546
Uniprot ID O96018

Related Products

Advertisement