shRNA Adeno-associated Virus Serotype 2, p7SK-(XKR6-shRNA-Seq1)(CAT#: AAV-SI3696WQ)
This product is a XKR6-shRNA encoding AAV, which is based on AAV-2 serotype. The XKR6 gene may play an important role in cell apoptotic process. The expression of XKR6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | XKR6-shRNA-Seq1 |
Related Target/Protein | XKR6 |
Region | CDS |
TargetSeq | CCTCTATGAGTTGCTACAGTA |
NCBI RefSeq | NM_173683 |
Alternative Names | XRG6; C8orf5; C8orf7; C8orf21 |
Titer | >1*10^10 GC/mL |