shRNA Adeno-associated Virus Serotype 2, pH1-(2310039H08Rik-shRNA-Seq1)(CAT#: AAV-SI3123WQ)

This product is a 2310039H08Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 2310039H08Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert 2310039H08Rik-shRNA-Seq1
Related Target/Protein 2310039H08Rik
Region 3UTR
TargetSeq GATGCCAAATTTCAACTTCAT
NCBI RefSeq NM_025966
Titer >1*10^10 GC/mL
Target Gene
Gene ID 67101
Uniprot ID Q9D727

Related Products

Advertisement