shRNA Adeno-associated Virus Serotype 2, pU6-(C3orf52-shRNA-Seq1)(CAT#: AAV-SI0271WQ)

This product is a C3orf52-shRNA encoding AAV, which is based on AAV-2 serotype. The C3orf52 encoded protein is a TPA-induced transmembrane protein. The expression of C3orf52-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C3orf52-shRNA-Seq1
Related Target/Protein C3orf52
Region CDS
TargetSeq GCTTATGTCTTGCTGCAGTAA
NCBI RefSeq NM_024616
Alternative Names TTMP
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 79669
Uniprot ID Q5BVD1

Related Products

Advertisement