shRNA Adeno-associated Virus Serotype 2, pH1-(CABIN1-shRNA-Seq2)(CAT#: AAV-SI0729WQ)

This product is a CABIN1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by CABIN1 gene binds specifically to the activated form of calcineurin and inhibits calcineurin-mediated signal transduction. The expression of CABIN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert CABIN1-shRNA-Seq2
Related Target/Protein CABIN1
Region CDS
TargetSeq GAGGAGGAAGATGATTCCTTT
NCBI RefSeq NM_012295
Alternative Names CAIN; PPP3IN; KB-318B8.7
Titer >1*10^10 GC/mL
Related Diseases Glomerular podocyte injury
Target Gene
Gene ID 23523
Uniprot ID Q9Y6J0

Related Products

Inquiry Now
Advertisement