shRNA Adeno-associated Virus Serotype 2, pH1-(Csprs-shRNA-Seq4)(CAT#: AAV-SI2861WQ)
This product is a Csprs-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Csprs-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Csprs-shRNA-Seq4 |
Related Target/Protein | Csprs |
Region | 3UTR |
TargetSeq | CCTGTTTAGAAACTGTTCTTT |
NCBI RefSeq | NM_033616 |
Alternative Names | HSR; D1Lub1 |
Titer | >1*10^10 GC/mL |