shRNA Adeno-associated Virus Serotype 2, pH1-(Patl2-shRNA-Seq1)(CAT#: AAV-SI3171WQ)

This product is a Patl2-shRNA encoding AAV, which is based on AAV-2 serotype. The Patl2 gene encodes a RNA-binding protein that acts as a translational repressor. The expression of Patl2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Patl2-shRNA-Seq1
Related Target/Protein Patl2
Region CDS
TargetSeq CAGGGTTGAGTTTCTCCAGTT
NCBI RefSeq NM_026251
Alternative Names OOMD4; Pat1a; hPat1a
Titer >1*10^10 GC/mL
Target Gene
Gene ID 197135
Uniprot ID C9JE40

Related Products

Advertisement