shRNA Adeno-associated Virus Serotype 2, pH1-(PIGW-shRNA-Seq1)(CAT#: AAV-SI0640WQ)
This product is a PIGW-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by PIGW gene is an inositol acyltransferase that acylates the inositol ring of phosphatidylinositol. Defects in this gene are a cause of the age-dependent epileptic encephalopathy West syndrome as well as a syndrome exhibiting hyperphosphatasia and cognitive disability (HPMRS5). The expression of PIGW-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | PIGW-shRNA-Seq1 |
Related Target/Protein | PIGW |
Region | CDS |
TargetSeq | GCCCTCGGCATTACTGTATTA |
NCBI RefSeq | NM_178517 |
Alternative Names | Gwt1; HPMRS5 |
Titer | >1*10^10 GC/mL |
Related Diseases | Hyperphosphatasia and mental retardation syndrome |