shRNA Adeno-associated Virus Serotype 2, pH1-(PLEKHA6-shRNA-Seq1)(CAT#: AAV-SI0888WQ)
This product is a PLEKHA6-shRNA encoding AAV, which is based on AAV-2 serotype. The PLEKHA6 gene is associated with psychopathology and response to treatment in schizophrenic patients.The expression of PLEKHA6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | PLEKHA6-shRNA-Seq1 |
Related Target/Protein | PLEKHA6 |
Region | CDS |
TargetSeq | CCAGCATTATGACGTGGACAT |
NCBI RefSeq | NM_014935 |
Alternative Names | PEPP3; PEPP-3 |
Titer | >1*10^10 GC/mL |
Related Diseases | Schizophrenic |