shRNA Adeno-associated Virus Serotype 2, pH1-(RTBDN-shRNA-Seq1)(CAT#: AAV-SI0874WQ)

This product is a RTBDN-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by RTBDN gene is preferentially expressed in the retina and may play a role in binding retinoids and other carotenoids as it shares homology with riboflavin binding proteins. The expression of RTBDN-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert RTBDN-shRNA-Seq1
Related Target/Protein RTBDN
Region CDS
TargetSeq CCTTACCTATGGACAGACCTT
NCBI RefSeq NM_031429
Titer >1*10^10 GC/mL
Related Diseases Eye disease
Target Gene
Gene ID 83546
Uniprot ID Q9BSG5

Related Products

Advertisement