shRNA Adeno-associated Virus Serotype 2, pU6-(C4orf37-shRNA-Seq2)(CAT#: AAV-SI0333WQ)
This product is a C4orf37-shRNA encoding AAV, which is based on AAV-2 serotype. The C4orf37 gene may be associated with male factor infertility. The expression of C4orf37-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | C4orf37-shRNA-Seq2 |
| Related Target/Protein | C4orf37 |
| Region | 3UTR |
| TargetSeq | CGCTCAGGCTTTAGTGACTAT |
| NCBI RefSeq | NM_174952 |
| Alternative Names | STPG2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |
