shRNA Adeno-associated Virus Serotype 2, pH1-(ZER1-shRNA-Seq1)(CAT#: AAV-SI2512WQ)
This product is a ZER1-shRNA encoding AAV, which is based on AAV-2 serotype. The ZER1 gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The expression of ZER1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | ZER1-shRNA-Seq1 |
Related Target/Protein | ZER1 |
Region | CDS |
TargetSeq | CATAGGAATATGCTAGGACTT |
NCBI RefSeq | NM_006336 |
Alternative Names | ZYG; C9orf60; ZYG11BL |
Titer | >1*10^10 GC/mL |