shRNA Adeno-associated Virus Serotype 2, pH1-(PATL1-shRNA-Seq3)(CAT#: AAV-SI0606WQ)

This product is a PATL1-shRNA encoding AAV, which is based on AAV-2 serotype. The PATL1 gene encodes a involved in deadenylation-dependent decapping of mRNAs, leading to the degradation of mRNAs. Acts as a scaffold protein that connects deadenylation and decapping machinery. The expression of PATL1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert PATL1-shRNA-Seq3
Related Target/Protein PATL1
Region 3UTR
TargetSeq GCCATCACCAATGGAGTGTTT
NCBI RefSeq NM_152716
Alternative Names Pat1b; hPat1b
Titer >1*10^10 GC/mL
Related Diseases Hepatitis C virus (HCV) infection
Target Gene
Gene ID 219988
Uniprot ID Q86TB9

Related Products

Inquiry Now
Advertisement