shRNA Adeno-associated Virus Serotype 2, pU6-(AARSD1-shRNA-Seq3)(CAT#: AAV-SI0345WQ)
This product is a AARSD1-shRNA encoding AAV, which is based on AAV-2 serotype. The AARSD1 gene functions in trans to edit the amino acid moiety from incorrectly charged tRNA(Ala). The expression of AARSD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | AARSD1-shRNA-Seq3 |
Related Target/Protein | AARSD1 |
Region | CDS |
TargetSeq | CCTGATATTTCTGTCTGGGAA |
NCBI RefSeq | NM_025267 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |