shRNA Adeno-associated Virus Serotype 2, pU6-(C1orf138-shRNA-Seq2)(CAT#: AAV-SI0138WQ)

This product is a C1orf138-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C1orf138-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C1orf138-shRNA-Seq2
Related Target/Protein C1orf138
Region 3UTR
TargetSeq CGGATGCTCACATTTCTCTTT
NCBI RefSeq NM_001025493
Alternative Names ADAMTSL4-AS1
Titer >1*10^10 GC/mL
Related Diseases Multiple sclerosis
Target Gene
Gene ID 574406
Uniprot ID Q5T5F5

Related Products

Advertisement