shRNA Adeno-associated Virus Serotype 2, p7SK-(LAMP3-shRNA-Seq1)(CAT#: AAV-SI1241WQ)
This product is a LAMP3-shRNA encoding AAV, which is based on AAV-2 serotype. LAMP3 regulates hepatic lipid metabolism through activating PI3K/Akt pathway. LAMP3 promotes the invasion of osteosarcoma cells via SPP1 signaling. LAMP3 expression correlated with poor clinical outcome in human ovarian cancer. The expression of LAMP3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | LAMP3-shRNA-Seq1 |
Related Target/Protein | LAMP3 |
Region | CDS |
TargetSeq | GTCAGTCAAGACTGGAATTTA |
NCBI RefSeq | NM_014398 |
Alternative Names | LAMP; CD208; DCLAMP; LAMP-3; TSC403; DC LAMP; DC-LAMP |
Titer | >1*10^10 GC/mL |
Related Diseases | Oral squamous cell carcinoma |