shRNA Adeno-associated Virus Serotype 2, pU6-(C3orf15-shRNA-Seq1)(CAT#: AAV-SI0458WQ)
This product is a C3orf15-shRNA encoding AAV, which is based on AAV-2 serotype. The C3orf15 gene may play a role in spermatogenesis and regulate cilium motility through its role in the assembly of the axonemal radial spokes. The expression of C3orf15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | C3orf15-shRNA-Seq1 |
| Related Target/Protein | C3orf15 |
| Region | CDS |
| TargetSeq | CAAGGCAGAACCATACACTTT |
| NCBI RefSeq | NM_033364 |
| Alternative Names | AAT1; CFAP91; MAATS1; CaM-IP2; SPATA26; AAT1alpha |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Kartagener syndrome |
