shRNA Adeno-associated Virus Serotype 2, pH1-(SDHAF2-shRNA-Seq2)(CAT#: AAV-SI0979WQ)

This product is a SDHAF2-shRNA encoding AAV, which is based on AAV-2 serotype. The SDHAF2 gene encodes a mitochondrial protein needed for the flavination of a succinate dehydrogenase complex subunit required for activity of the complex. The expression of SDHAF2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert SDHAF2-shRNA-Seq2
Related Target/Protein SDHAF2
Region CDS
TargetSeq CCTGCTCTATGAGAGCAGAAA
NCBI RefSeq NM_017841
Alternative Names PGL2; SDH5; C11orf79
Titer >1*10^10 GC/mL
Related Diseases Paraganglioma
Target Gene
Gene ID 54949
Uniprot ID Q9NX18

Related Products

Inquiry Now
Advertisement