shRNA Adeno-associated Virus Serotype 2, pH1-(HOOK2-shRNA-Seq2)(CAT#: AAV-SI2468WQ)

This product is a HOOK2-shRNA encoding AAV, which is based on AAV-2 serotype. The HOOK2 gene encodes a member of Hook proteins that are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The expression of HOOK2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert HOOK2-shRNA-Seq2
Related Target/Protein HOOK2
Region CDS
TargetSeq GCTATTTGAATGCCGCAACCT
NCBI RefSeq NM_013312
Alternative Names HK2
Titer >1*10^10 GC/mL
Related Diseases Obesity and type 2 diabetes
Target Gene
Gene ID 29911
Uniprot ID Q96ED9

Related Products

Inquiry Now
Advertisement