shRNA Adeno-associated Virus Serotype 2, p7SK-(C5orf13-shRNA-Seq2)(CAT#: AAV-SI1459WQ)

This product is a C5orf13-shRNA encoding AAV, which is based on AAV-2 serotype. The C5orf13 gene may have roles in neural function and cellular differentiation. The expression of C5orf13-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C5orf13-shRNA-Seq2
Related Target/Protein C5orf13
Region CDS
TargetSeq CAAGAACCATTTCCAAACAAG
NCBI RefSeq NM_004772
Alternative Names P311; PTZ17; SEZ17; D4S114; NREP; PRO1873
Titer >1*10^10 GC/mL
Related Diseases Breast Cancer
Target Gene
Gene ID 9315
Uniprot ID Q16612

Related Products

Inquiry Now
Advertisement