shRNA Adeno-associated Virus Serotype 2, pU6-(GOLGA8E-shRNA-Seq2)(CAT#: AAV-SI0378WQ)

This product is a GOLGA8E-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of GOLGA8E-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert GOLGA8E-shRNA-Seq2
Related Target/Protein GOLGA8E
Region CDS
TargetSeq CCCACAAGCATGGTGATCTTT
NCBI RefSeq NM_001012423
Titer >1*10^10 GC/mL
Related Diseases Prader-Willi syndrome (PWS)
Target Gene
Gene ID 390535
Uniprot ID Q08AF8

Related Products