shRNA Adeno-associated Virus Serotype 2, pU6-(Zcchc5-shRNA-Seq1)(CAT#: AAV-SI2218WQ)

This product is a Zcchc5-shRNA encoding AAV, which is based on AAV-2 serotype. The Zcchc5 gene is a member of a family of gag-related retrotransposon genes. These genes appear to have lost the ability to retrotranspose. The expression of Zcchc5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Zcchc5-shRNA-Seq1
Related Target/Protein Zcchc5
Region CDS
TargetSeq CCACCAACCTATCTGATGTGA
NCBI RefSeq NM_199468
Alternative Names Mar3; ZHC5; Mart3; SIRH9; ZCCHC5; RTL3
Titer >1*10^10 GC/mL
Target Gene
Gene ID 203430
Uniprot ID Q8N8U3

Related Products

Advertisement