shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(FAM36A-shRNA-Seq1)(CAT#: AdV-SI1500WQ)
This product is a FAM36A-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The FAM36A gene encodes a protein that plays a role in the assembly of cytochrome C oxidase, an important component of the respiratory pathway. The expression of FAM36A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | FAM36A-shRNA-Seq1 |
Related Target/Protein | FAM36A |
Region | CDS |
TargetSeq | CTTTGGGATGCTGGTTTCATT |
NCBI RefSeq | NM_198076 |
Alternative Names | COX20 |
Titer | >1*10^10 GC/mL |
Related Diseases | Mitochondrial complex IV deficiency |